A periodical of the Faculty of Natural and Applied Sciences, UMYU, Katsina
ISSN: 2955 – 1145 (print); 2955 – 1153 (online)
ORIGINAL RESEARCH ARTICLE
Yunusa Saheed1, Inusa Titus2, Mahmud Yerima Iliyasu2 and Ahmed Farouk Umar2
1Department of Microbiology, Yobe State University, Damaturu, Nigeria
2Department of Microbiology, Abubakar Tafawa Balewa University, Bauchi, Nigeria
Corresponding Author: ititus@atbu.edu.ng
The continued detection and dissemination of multidrug-resistant (MDR) Shigella species pose a significant public health threat worldwide, especially in resource-limited regions such as the Northeast, Nigeria. Extended-Spectrum Beta-Lactamases (ESBLs) encoded by genes including BlaSHV confer resistance to critical Beta-lactam antibiotics, and sulfonamide resistance genes such as sul2 complicate therapeutic regimens by mediating resistance to widely used drugs. The available data on ESBL and sulfonamide genes producing Shigella from African countries reflects limited technical resources, the absence of a national or regional surveillance system, and the lack of required publications for the limited data generated. This Study reports the genotypic detection confirming BlaSHV and Sul2 resistance genes from multidrug-resistant Shigella Flexneri isolates from clinical specimens in Yobe State Specialist Hospital, Damaturu. The identified MDR phenotype Shigella species were collected, and their DNA was extracted and amplified using multiplex and simple PCR with various primer sets targeting specific sequences of the resistance genes. The gel images were then taken. Among five MDR Shigella strains tested by multiplex PCR against three β-lactamases (BlaTEM, BlaCTX-M, and BlaSHV), BlaSHV was detected in a Shigella flexneri strain. In this Study, no blaTEM and blaCTX-M genes were detected in any of the five products. In addition, two isolates (all Shigella flexneri strains) were found to harbor Sul2 genes, while only one MDR Shigella flexneri isolate harbored both BlaSHV and Sul2 resistance genes, unlike the potential XDR Shigella flexneri, which carries only the Sul2 resistance gene. MDR Shigella flexneri strains isolated from Specialist Hospital, Damaturu, Yobe State, are a reservoir of disseminatable BlaSHV and Sul2 resistance genes. However, despite its limitations, this Study highlights the urgent need for enhanced molecular antimicrobial stewardship and targeted interventions to curb the spread of resistant Shigella clones in this vulnerable region.
Keywords: Shigella flexneri, PCR, Yobe, Antimicrobial resistance
An estimated 165 million cases of shigellosis are reported annually, with about a million deaths worldwide. Most data from developing countries are culture-based based making it difficult to evaluate the accurate burden of Shigella infection in developing countries due to the limited scope of studies and lack of coordinated epidemiological surveillance systems (Somda et al., 2025). New disease burden estimates from newly deployed molecular diagnostic assays with increased sensitivity suggest that Shigella-associated morbidity may be much greater than previous disease estimates from culture-based methods (Anderson et al., 2023).
Extended-spectrum β-lactamases are mutant forms of broad-spectrum β-lactamases such as the TEM-1, TEM-2, and SHV-1 enzymes coded by genes located on transferable plasmids, which can easily spread from one organism to another (Shahnaij et al., 2023). The global spread of ESBL-producing bacteria is largely driven by the dissemination of these three major gene families: BlaTEM, BlaCTX-M, and BlaSHV, yet to know which genes encode ESBL in Nigeria, and to know the exact prevalence of every ESBL gene would be of importance (Hertz et al., 2019). They encode enzymes capable of hydrolyzing and inactivating a wide range of β-lactam antibiotics. The accurate and rapid identification of these specific ESBL genotypes is of paramount importance for clinical diagnostics, epidemiological surveillance, and infection control (Losio et al., 2015).
Just like the ESBL, the molecular detection of Sul2 genes is also crucial for understanding the epidemiology of sulfonamide resistance and for monitoring its prevalence in both clinical and agricultural settings (Titus et al., 2023). Regional antimicrobial susceptibility profiles of each organism need to be monitored, as evidenced by the persistently shifting patterns of common species and the resistance of Shigella isolates in Nigeria (GLASS, 2025). Polymerase Chain Reaction (PCR) assays designed to target these genes provide a reliable means of identifying β-lactamase and sulfonamide-resistant bacteria, often with greater sensitivity and specificity than traditional susceptibility testing methods (Osose et al., 2025).
Phenotypically, multi-drug resistance prevalence has been reported in Shigella species from every state in the north-east and all other geopolitical zones of Nigeria, including: Damaturu (Saheed et al., 2020), Maiduguri (Ngoshe et al., 2017), Bauchi (Umar et al., 2025), Adamawa (Tula et al., 2022), all from the north-east, Nigeria. In the three zones of Odeda, south-west (Ajayi et al., 2019), and Makudi, north-central (Richard et al., 2023). A similar wide range of resistance phenotypes has been reported from Kano and Kaduna, northwest (Alhaji et al., 2022; Lawal, 2017), and Enugu, southeast (Osose et al., 2025).
Genotypically, the components that are thought to be in charge of antimicrobial Resistance (AMR) acquisition and spread among organisms are clinically of immense importance. Whole-genome sequencing technology for routine microbiology has recently advanced, as widely reported (Leopold et al., 2014) in developed countries. Yet, not many studies on the Shigella species' genetic makeup have been finished, despite substantial progress having been achieved in understanding the pathogenesis (Sahl et al., 2015) and aid vaccine production (Anderson et al., 2016; Mani et al., 2016). The detection of blaSHV (beta-lactamase) and sul2 (sulfonamide resistance) genes by PCR is crucial for understanding multi-drug resistance (MDR) in Shigella flexneri. These genes are widely reported in clinical and foodborne isolates, contributing to resistance against beta-lactam and sulfonamide antibiotics.
On the other hand, Molecular studies is just getting attention in the sub-Sahara Africa (Baumgart et al., 2024), no dedicated national or regional surveillance of diarrheagenic organisms and their AMR pattern in Nigeria (NAP, 2024) and the only available data are from institutional and academic research which are also minimal (Kahsay & Muthupandian, 2016; The et al., 2016).
Currently, there is a published (widely indexed or accessible) literature gap regarding the PCR characterization of Shigella resistance genes in the northeastern, Nigeria (especially in Bauchi and Yobe States). This study aims to fill the grey research gap. The resistance genes detected are particularly important due to their plasmid-borne nature and high transfer potential, making them critical markers for surveillance in regions with a high AMR burden.
The phenotypic identification, susceptibility profile, MAR indices, Genotypic identification, and phylogenetic information of the five drug-resistant isolates used in this Study have been described in our previous Study (Saheed et al., 2025).
DNA extraction was done using the kit method. After culturing isolates in lysogeny broth overnight, the isolates' total genomic DNA was extracted following the Accu prep Genomic DNA extraction kit (Bioneer) instructions.
PCR assay was used to amplify and detect drug resistance genes in Shigella isolates. The resistance genes (BlaSHV and Sul2), which encode Extended Beta-Lactamases and Sulfonamides, were investigated in the tested antibiotics of the case study subjects. Multiplex PCR was carried out using optimized primers listed in Table 1. Multiplex PCR targeted ESBL genes (BlaCTX, BlaTEM, and BlaSHV) with the following setup and conditions: 16 µL of distilled water (dH2O), 1 µL each of forward and reverse primers (Bioneer), and 2 µL of template DNA. The reaction underwent a pre-denaturation at 95°C for 5 minutes, followed by denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 40 seconds, repeated for 35 cycles. A final extension was performed at 72°C for 5 minutes using a Thermal Cycler PTC 100, MJ Research. The presence of sul2 was determined using the same PCR conditions, except for an annealing temperature of 50°C (Iliyasu et al., 2018).
Agarose gel electrophoresis was performed using commercially available agarose (TAE). A 3 g sample of agarose was dissolved in a solution and heated in a microwave until fully dissolved. The solution was cooled in a water bath to 50-55°C. The gel casting tray was prepared by sealing the ends of the gel chamber with tape, and an appropriate number of combs were placed in the tray. 5 µL of ethidium bromide was added to the gel mixture, which was then cooled before being poured into the gel tray. The gel was allowed to solidify for 23 minutes at room temperature. Afterward, the combs were removed, the gel was placed in the electrophoresis chamber, and covered with buffer (TAE).
The DNA mixture and standards (Ladder) were loaded onto the gel, electrophoresed at 5V/cm for 1hour, and the DNA bands were visualized using a UV lightbox (gel imaging system, Biorad) (Abbasi et al., 2019).
Table 1: Oligonucleotide primers used for resistance gene amplification in this Study
| Primers | Sequences 5ˊ-3ˊ | Amplicon size(bp) | Reference | |
|---|---|---|---|---|
| BlaTem | F – | GTA TCC GCT CAT GAG ACA ATA ACC | 918 | (Pan et al., 2006) |
| R – | CTG CCA ATG CTT AAT CAG TGA GGC ACC | |||
| BlaCTX | F – | CGC TTT GCG ATG TGC AG | 550 | |
| R – | ACC GCG ATA TCG TTG GT | |||
| BlaSHV | F – | CGC CTG TGT ATT ATC TCC CTG TTA GCC | 842 | |
| R – | TTG CCA GTG CTC GAT CAG CG | |||
| Sul2 | F – | AGGGGGCAGATGTGATCGAC | 625 | (De et al., , 2020) |
| R – | TGTGCGGATGAAGTCAGCTCC |
Table 2: Summary of the Multi-Drug-Resistant Shigella species Used in this Study
| Shigella spp | MARI | Antibiotic Resistance Pattern | BlaSHV | Sul2 |
|---|---|---|---|---|
| Shigella flexneri | 0.412 | CXM, CAZ, AMX, AMP, S, TET, CLN | + | + |
| Shigella boydii | 0.176 | CXM, CAZ, CLN | - | - |
| Shigella boydii | 0.529 | CXM, CAZ, CFM, CRO, AMX, AMP, S, CLN, SXT | - | - |
| Shigella boydii | 0.529 | CXM, CAZ, CFM, CRO, AMX, AMP, S, CLN, SXT | - | - |
| Shigella flexneri | 0.882 | CXM, CAZ, CFM, CRO, AMX, AMP, TZO, IP, CIP, LVX, S, AZM, TET, CLN, SXT | - | + |
Keys: + = Detected, - = Not Detected, MARI = Multiple Antibiotics Resistance Index
The results for the determination of Antibacterial drug resistance by the multiplex PCR technique are shown in Figure 1. Despite the wide range of phenotypic resistance to Β-Lactamase antibiotics demonstrated by the Shigella isolates in this Study (Saheed et al., 2025), no BlaCTX gene or BlaTEM gene was detected. Only BlaSHV genes (824bp) were amplified from a Shigella flexneri strain . The amplification showed a broad visible band on the BlaSHV lane. Other products (one strain of Shigella flexneri and three strains of Shigella boydii) in lanes 2, 3, 4, and 5 showed no detectable amplification of those particular β-lactamase genes. The negative control showed no bands, indicating a clean PCR setup and no false positives. The positive control showed bands matching the expected positive control gene products, confirming the presence of bands for two positive controls (blaSHV and blaCTX).
The PCR product showed clear bands on lanes 1 and 5, detected at 625bp (Figure 2), which matches the positive control, indicating successful and specific amplification of the sul2 gene. The presence of a 625bp band is expected and a specific product for the sul2 gene amplification. Its appearance in the correct test lanes and the positive control confirms effective and specific PCR for the sul2 genes. Other products (all Shigella boydii strains) in lanes 2, 3, and 4 show no bands, similar to the negative control. This strongly suggests that the sul2 gene is not amplified in these samples. The presence of positive bands in other lanes and proper control results indicate a true negative (not detectable sul2 gene) in these PCR products.
Figure 1: Agarose gel image of amplified β-lactamases (BlaSHV) genes in DNA samples from MDR Shigella isolates using multiplex PCR. Lane M is the DNA ladder. Lane 1 shows a BlaSHV band at 800 bp, while lanes 2, 3, 4, and 5 show no detectable bands, indicating negative results for blaTEM, blaSHV, and blaCTX. Lane -ve = negative control & +ve = positive controls (CTX and TEM).
Figure 2: Agarose gel image of amplified PCR products Sulfonamide (sul2) genes in DNA samples of the MDR Shigella isolates. Lane M: The DNA Ladder, Lanes 1 & 5 show a positive result for the sul2 band at 625 bp. No band is present in Lanes 2, 3, and 4. Lane -ve & +ve are negative & positive controls, respectively.
Genotypically, two resistant genes were detected through PCR methods. Extended-spectrum β-lactamase resistance gene (BLA SHV) was detected in MDR Shigella flexneri, and the sulfonamide resistance gene (Sul2) was detected in two strains of MDR Shigella flexneri, including a potential XDR phenotype. This study outcome has confirmed the presence of BlaSHV in the PCR product with similar results reported at the same 800bp (Karmoker et al., 2023; Tahmasbi et al., 2024) using a single PCR. Using multiplex PCR, Shahnaij et al. (2023) reported amplified BlaSHV at around 800bp when using standard primer sets similar to the ones used in this Study. Multiple studies confirm the presence of BlaSHV in MDR Shigella flexneri. In one foodborne Study, all Shigella isolates, including S. flexneri, carried BlaSHV, indicating its widespread role in beta-lactam resistance (Pakbin et al., 2021). However, some regional studies (e.g., Iran) did not detect BlaSHV, suggesting geographic variability (Sheikh et al., 2020).
Meanwhile, Somda et al. (2025) compiled recent molecular studies worldwide reported that BlaSHV is usually detected using PCR at the same base pair. Despite Dallal et al. (2018) not detecting BlaCTX-M, BlaTEM, except BlaSHV in Shigella species, others (Bajpai et al., 2017; Kaur & Aggarwal, 2013; Michael & Saadi, 2018; Nkengkana et al., 2023) have been able to detect all the genes (BlaCTX-M, BlaTEM, BlaSHV) in some β-lactamase-resistant enterobacteria while only amplifying BlaSHV in three (3) strains of Klebsiella pneumoneae. Bands for BlaSHV were consistently observed at their expected amplicon size (usually 800–900bp depending on primers), and this protocol continues to inform contemporary research (Dallal et al., 2018).
No verifiable BlaSHV harboring Shigella species have been reported from Bauchi and Damaturu specifically, but multiplex PCR for detection of pathogenic Shigella species, different species-specific amplicons at 159 bp (Shigella genus), 248 bp (S. boydii), 503 bp (S. sonnei), and 314 bp (S. flexneri) have been reported in Terra, Iran (Ranjbar et al., 2014) and India (Nandi et al., 2023). This has, though, been reported in other bacteria such as Salmonella typhi (Umar et al., 2025), Escherichia coli (Iliyasu et al., 2018) from Bauchi, Klebsiella pneumoneae (Ngolo et al., 2023) from Lafia, Nasarawa state, and other parts of the country (Mustapha et al., 2023).
There are limited reports on the detection of sul2 in studies from Damaturu and Bauchi with 1.213 and 0.131 density compared to the positive control as found in this Study (1YS and 5YS) sulfonamide resistance sul1 gene has been reported from Salmonella typhi in Bauchi (Titus et al., 2023) and (sul1 and sul2) well documented in Nigeria (Osose et al., 2025).
In support of this Study, the sul2 gene, which confers resistance to sulfonamides, is frequently detected in clinical S. flexneri isolates, with 47% of strains from a pediatric cohort in China showing its presence. This presence was significantly associated with resistance to sulfamethoxazole-trimethoprim (SXT) (Peng et al., 2024). In Pakistan, sul2 was found in 63% of serotype 2b S. flexneri isolates, a serotype strongly linked to MDR (Nisa et al., 2020).
In contrast, all SXT-resistant (sulfamethoxazole/trimethoprim) Shigella species isolated from different Chinese regions using PCR confirmed a high prevalence of sul genes targeted at 625bp, particularly sul1 and sul2, which commonly served as molecular markers for resistance surveillance (Isaiah et al., 2025). This finding highlights the association of plasmid-borne sul genes at the expected 625bp region, correlating with phenotypic drug resistance (Asad et al., 2025). Ranjbar et al. (2014) indicated that sul1, sul2, and sul3 genes are common in Shigella species worldwide, detected by PCR amplicons close to 625bp. The sul1 gene, part of class 1 integrons, was highly frequent, and the sul2 gene is commonly found on both large and small plasmids in clinical Shigella isolates. The lack of detection of the genes in other MDR strains could result from various factors, including genetic diversity and variability from mutations, the use of alternative resistance mechanisms such as other Sul genes instead of sul2, and plasmid instability (Deng et al., 2025).
While this Study provides valuable insights on the detection of the resistant genes (BlaSHV and Sul2) in Shigella isolates, the findings should be interpreted carefully due to its limitations, particularly the small sample size and the exclusive reliance on 16S rRNA partial gene sequencing rather than whole genome sequencing for bacterial identification.
In conclusion, this Study provides molecular evidence for the occurrence of transferable BlaSHV and Sul2 resistance genes among multidrug-resistant Shigella flexneri isolates recovered from Yobe State, Nigeria. Although the analysis was based on a limited number of isolates, the findings suggest the possible circulation of these resistance determinants in the region. BlaSHV and sul2 genes are prevalent and clinically significant resistance markers in MDR Shigella flexneri, with PCR serving as a reliable detection method; these underscore the value of broader, systematic molecular surveillance to better characterize their distribution and epidemiological relevance.
Abbasi, E., Abtahi, H., van Belkum, A., & Ghaznavi-Rad, E. (2019). Multidrug-resistant shigella infection in pediatric patients with diarrhea from central Iran. Infection and Drug Resistance, 12, 1535–1544. [Crossref]
Ajayi, O. I., Ojo, D. A., Akintokun, A. K., & Akinrotoye, K. P. (2019). Prevalence and Antibiotic Resistance Profiles of Serotypes of Shigella Species isolated from Community Children in Odeda Local Government, Ogun State. Journal of Environmental Treatment Techniques, 7(3), 270–281.
Alhaji, A. I., Mulade, G. L., Ajibade, G. A., Haroun, A. A., & Benjamin, O. I. (2022). Multiple Antibiotic Resistance Indices of Shigella flexneri and Salmonella enterica Associated with Diarrhoea in Children (0-5 Years) From Selected Hospitals in Kaduna Metropolis, Nigeria. Nigerian Journal of Microbiology, 36(2), 6300–6309.
Anderson, J. D., Bagamian, K. H., Pecenka, C. J., Muhib, F., Puett, C. A., Hausdorff, W. P., & Scheele, S. (2023). Potential impact and cost-effectiveness of Shigella vaccination in 102 low-income and middle-income countries in children aged 5 years or younger: A modelling study. The Lancet Global Health, 11(6), e880–e891. [Crossref]
Anderson, M., Sansonetti, P. J., & Marteyn, B. S. (2016). Shigella Diversity and Changing Landscape: Insights for the Twenty-First Century. Frontiers in Cellular and Infection Microbiology, 6. [Crossref]
Asad, A., Nayeem, M. A. J., Mostafa, M. G., Begum, R., Faruque, S. N., Nusrin, S., Jahan, I., Hayat, S., & Islam, Z. (2025). Resistome phylodynamics of multidrug-resistant Shigella isolated from diarrheal patients. Microbiology Spectrum, 13(1), e01635-24. [Crossref]
Bajpai, T., Pandey, M., Varma, M., & Bhatambare, G. S. (2017). Prevalence of TEM, SHV, and CTX-M Beta-Lactamase genes in the urinary isolates of a tertiary care hospital. Avicenna Journal of Medicine, 7(1), 12–16. [Crossref]
Baumgart, S., Phan, T., & McKew, G. (2024). Epidemiology and antimicrobial resistance rates for Shigella species in a resource-rich setting. Pathology, 57(1), 94–99. [Crossref]
Dallal, M. M. S., Ranjbar, R., Yaghoubi, S., Rajabi, Z., Aminharati, F., & Behrooz, H. R. A. (2018). Molecular epidemiology and genetic characterization of Shigella in pediatric patients in Iran. Infezioni in Medicina, 26(4), 321–328.
De, R., Mukhopadhyay, A. K., & Dutta, S. (2020). Molecular Analysis of Selected Resistance Determinants in Diarrheal Fecal Samples Collected From Kolkata, India Reveals an Abundance of Resistance Genes and the Potential Role of the Microbiota in Its Dissemination. Frontiers in Public Health, 8, 61. [Crossref]
Deng, S., Li, C., Zhang, H., Xie, Y., Wang, X., Luo, W., Chen, Z., & Tang, F. (2025). Analyzing Shigella in Wuhan: Serotypes, Antimicrobial Resistance, and Public Health Implications. Infection and Drug Resistance, Volume 18, 3745–3760. [Crossref]
Global Antimicrobial Resistance and Use Surveillance System (GLASS) report. (2025). Antibiotic use data for 2022 (No. CC BY-NC-SA 3.0 IGO; pp. 1–39). World Health Organization. [Link]
Hertz, F. B., Jansåker, F., Okon, K. O., Abdulmumin, I. S., Onah, J. O., Ladan, J., & Knudsen, J. D. (2019). ESBL‐production in Escherichia coli and Klebsiella pneumoniae isolates from Nigeria. MicrobiologyOpen, 8(9), e00816. [Crossref]
Iliyasu, M. Y., Uba, A., & Agbo, E. B. (2018). Phenotypic detection of multidrug resistant extended-spectrum beta-lactamase (ESBL) producing Escherichia coli from clinical samples. African Journal of Cellular Pathology, 10(2), 25–32. [Crossref]
Isaiah, D. O., Otokunefor, K., & Agbagwa, O. E. (2025). Multiple antibiotic resistance indexing and molecular identification of Escherichia coli isolated from clinical and nonclinical sources in Port Harcourt Metropolis, Nigeria. Pan African Medical Journal, 51. [Crossref]
Kahsay, A. G., & Muthupandian, S. (2016). A review on Sero diversity and antimicrobial resistance patterns of Shigella species in Africa, Asia and South America, 2001-2014. BMC Research Notes, 9(1), 422. [Crossref]
Karmoker, J., Saiful Islam, M., Liton Rana, M., Ashek Ullah, M., Neloy, F. H., Oishy, N. M., Pramanik, P. K., Siddique, M. P., Saha, S., & Tanvir Rahman, M. (2023). Molecular Detection and Multidrug Resistance of Shigella spp. Isolated from Wild Waterfowl and Migratory Birds in Bangladesh. Veterinary Medicine International, 2023(1), 5374216. [Crossref]
Kaur, M., & Aggarwal, A. (2013). Occurrence of the CTX-M, SHV and the TEM genes among the extended spectrum β-lactamase producing isolates of enterobacteriaceae in a tertiary care hospital of north India. Journal of Clinical and Diagnostic Research, 7(4), 642–645. [Crossref]
Lawal, M. S. (2017). Antimicrobial Resistance Pattern and Plasmid Profile of Diarrheal Salmonallae and Shigallae Bacteria Isolated from Clinical Samples in Kaduna Metropolis, Nigeria. Journal of Bacteriology & Mycology: Open Access, 4(2). [Crossref]
Leopold, S. J., van Leth, F., Tarekegn, H., & Schultsz, C. (2014). Antimicrobial drug resistance among clinically relevant bacterial isolates in sub-Saharan Africa: A systematic review. Journal of Antimicrobial Chemotherapy, 69(9), 2337–2353. [Crossref]
Losio, M. N., Pavoni, E., Bilei, S., Bertasi, B., Bove, D., Capuano, F., Farneti, S., Blasi, G., Comin, D., Cardamone, C., Decastelli, L., Delibato, E., De Santis, P., Di Pasquale, S., Gattuso, A., Goffredo, E., Fadda, A., Pisanu, M., & De Medici, D. (2015). Microbiological survey of raw and ready-to-eat leafy green vegetables marketed in Italy. International Journal of Food Microbiology, 210, 88–91. [Crossref]
Mani, S., Wierzba, T., & Walker, R. I. (2016). Status of vaccine research and development for Shigella. Vaccine, 34(26), 2887–2894. [Crossref]
Michael, N. S., & Saadi, A. T. (2018). Detection of bla CTX-M, bla TEM-01 and bla SHV Genes in Multidrug Resistant Uropathogenic E. coli Isolated from Patients with Recurrent Urinary Tract Infections.
Mustapha, A., Chidiebere, O., Bata, M., Ali, Z., Victor, F., Yakubu, M., Tanko, N., & David, A. (2023). Fecal carriage rates of extended-spectrum Β-lactamase-producing Escherichia coli of inpatients and outpatients attending Yobe State Teaching Hospital, Damaturu, Nigeria. Microbes and Infectious Diseases, 0(0), 0–0. [Crossref]
Nandi, D., Kaur, K., & Janardhanan, R. (2023). Shigella storm and men who have sex with men: A perspective on the Indian context. Indian Journal of Public Health, 67(3), 480–481. [Crossref]
NAP. (2024). National Action Plan (NAP) on Antimicrobial Resistance: Situational Analysis and Key Recommendations for the Development of NAP 2.0. Federal Ministries of Agriculture and Food Security, Environment and Health and Social Welfare.
Ngolo, J. L., Orole, O. O., & Chuku, A. (2023). Epidemiology and Characteristics of Resistant Typhoidal Salmonella Strains Prevalent in Lafia, Nigeria. The Journal of Technology and Science, 34(1). [Crossref]
Ngoshe, I., Denue, B., Bello, H., Akawu, C., & Gashau, W. (2017). Prevalence and antimicrobial susceptibility of Shigella species isolates from diarrheal stool of patients in a tertiary health facility in northeastern Nigeria. Sub-Saharan African Journal of Medicine, 4(4), 96. [Crossref]
Nisa, I., Haroon, M., Qasim, M., Driessen, A., Nijland, J., Yasin, N., Jalal, A., Ali, N., Ullah, W., Khan, T., Begum, A., & Rahman, H. (2020). Association of Serotype with Antimicrobial Resistance Patterns Among Shigella flexneri Isolates from Pakistan: The Importance of Serotype 2b. The Pediatric Infectious Disease Journal. [Crossref]
Nkengkana, O. A., Founou, R. C., Founou, L. L., Dimani, B. D., Koudoum, P. L., Zemtsa, J. R., Mbossi, A., Mawout, C. S., Tegang, L. T., & Noubom, M. (2023). Phenotypic and genotypic characterization of multidrug resistant and extended-spectrum β-lactamase-producing Enterobacterales isolated from clinical samples in the western region in Cameroon. BMC Infectious Diseases, 23(1), 819. [Crossref]
Osose, E. B., Okafor, C. O., Ndidi, O. K., Ikechukwu, O., Onu, E., Francisca, A. U., Catherine, O. C., Felicia, O. N., Chimezie, N. M., Chinyere, N. A., Peter, I. E., & Iroha, I. R. (2025). Multidrug Resistant Salmonella Species Harboring Sulfonamide (Sul1 and Sul2) Resistant Gene Isolated from Typhoid Patients in a University Teaching Hospital - a Threat to Public Health. [Crossref]
Pakbin, B., Amani, Z., Allahyari, S., Mousavi, S., Mahmoudi, R., Brück, W., & Peymani, A. (2021). Genetic diversity and antibiotic resistance of Shigella spp. isolates from food products. Food Science & Nutrition, 9, 6362–6371. [Crossref]
Pan, J. C., Ye, R., Meng, D. M., Zhang, W., Wang, H. Q., & Liu, K. Z. (2006). Molecular characteristics of class 1 and class 2 integrons and their relationships to antibiotic resistance in clinical isolates of Shigella sonnei and Shigella flexneri. Journal of Antimicrobial Chemotherapy, 58(2), 288–296. [Crossref]
Peng, C. (2024). The relationship between integrons, antibiotic resistance genes and SXT resistance in Shigella flexneri strains. American Journal of Translational Research, 16(5), 1925–1934. [Crossref]
Ranjbar, R., Afshar, D., Tavana, A. M., Najafi, A., Pourali, F., Safiri, Z., Zanjani, R. S., & Jafari, J. (2014). Development of Multiplex PCR for Simultaneous Detection of Three Pathogenic Shigella Species. 43. [Crossref]
Richard, R., Ezejiofor, T. I. N., Nsofor, C. A., & Nkene, I. H. (2023). Antibacterial Resistance and Phenotypic Detection of Extended Spectrum Beta-Lactamase (ESBL) Producing Enterobacteriaceae Isolated from Environmental Sources in Nasarawa State, Nigeria. European Journal of Biology and Biotechnology, 4(5), 6–12. [Crossref]
Saheed, Y., Iliyasu, M. Y., Titus, I., Gulumbe, B. H., & Umar, A. F. (2025). Phenotypic and Genotypic Characterization of Drug Resistant Shigella Species Isolated from North-East, Nigeria. 35(10), 186–204. [Crossref]
Saheed, Y., Umar, A. F., & Iliyasu, M. (2020). Potential of Silver Nano Particles Synthesized from Ficus sycomorus Linn Against Multidrug Resistant Shigella species Isolated from Clinical Specimens. American Journal of Life Sciences, 8(4), 82. [Crossref]
Sahl, J. W., Morris, C. R., Emberger, J., Fraser, C. M., Ochieng, J. B., Juma, J., Fields, B., Breiman, R. F., Gilmour, M., Nataro, J. P., & Rasko, D. A. (2015). Defining the phylogenomics of Shigella species: A pathway to diagnostics. Journal of Clinical Microbiology, 53(3), 951–960. [Crossref]
Shahnaij, M., Amin, M. B., Hoque, M. M., Mondol, A. S., Rana, K. J., Azmi, I. J., & Talukder, K. A. (2023). Characterization of Shigella flexneri Serotype 6 Strains Isolated from Bangladesh and Identification of a New Phylogenetic Cluster. Journal of Bacteriology, 205(4), e00406-22. [Crossref]
Sheikh, A., Bandbal, M., & Saki, M. (2020). Emergence of multidrug-resistant Shigella species harboring extended-spectrum beta-lactamase genes in pediatric patients with diarrhea from southwest of Iran. Molecular Biology Reports, 47, 7097–7106. [Crossref]
Somda, N. S., Nyarkoh, R., Tankoano, A., Bonkoungou, O. J. I., Tetteh-Quarcoo, P. B., & Donkor, E. S. (2025). Molecular epidemiology of extended-spectrum beta-lactamases and carbapenemases-producing Shigella in Africa: A systematic review and meta-analysis. BMC Infectious Diseases, 25(1), 81. [Crossref]
Tahmasbi, S., Tabatabaee Bafroee, A. S., & Pakbin, B. (2024). Phenotypic and Genotypic Antibiotic Resistance Patterns of Clinical Shigella Isolates from Tehran, Iran. Jundishapur Journal of Microbiology, 17(4). [Crossref]
The, H. C., Thanh, D. P., Holt, K. E., Thomson, N. R., & Baker, S. (2016). The genomic signatures of Shigella evolution, adaptation and geographical spread. Nature Reviews Microbiology, 14(4), 235–250. [Crossref]
Titus, I., Iliyasu, M., Sahal, M., Umar, R., A, V. A., Wali, M., Ismail, S., Umar, A., & Agbo, E. (2023). Molecular Profiling of Class 1 Integron Among Multidrug-Resistant Salmonella Typhi Serovars Isolated from Hospitals in Bauchi. Acta Scientific Microbiology, 36–42. [Crossref]
Tula, M., Enabulele, O., Ophori, A., Aziegbemhin, A., Iyoha, O., & Filgona, J. (2022). Phenotypic and molecular detection of multi-drug resistant Enterobacteriaceae species from water sources in Adamawa-North senatorial zone Nigeria. DYSONA - Life Science, Online First. [Crossref]
Umar, R. D., Titus, I., Joseph, E., & Mamman, U. G. (2025). Molecular characterization of multidrug resistance genes and effect of zinc oxide nanoparticles on Salmonella typhi serovars from clinical specimens. Journal of Advances in Microbiology Research, 6(2), 100–105. [Crossref]