Genotyping of Uridine-Diphosphate Glucuronosyltransferases-1A1 (UGT1A1) Enzyme and Its Genetic Variant Allele Determination Using Polymerase Chain Reaction and Gel Electrophoresis
DOI:
https://doi.org/10.56919/usci.2324.003Keywords:
UGT1A1, Polymorphism, Doluegravir, HIV/AIDS, NanoDrop-1000Abstract
Dolutegravir is an integrase inhibitor that prevents the integration of the viral genome into the host cell’s DNA, thus halting HIV replication. The study aimed to conduct genotyping of immunocompromised patients in some Southern States of Nigeria on dolutegravir-based highly active antiretroviral therapy for the UGT1A1*6 and UGT1A1*28 variant alleles using gel electrophoresis and polymerase chain reaction. 52 HIV/AIDS patients participated in the study. Specific primers for UGT1A1*6 and UGT1A1*28: U1F1 forward primer: 5 – AGATACTGTTGATCCCAGTG - 3 and U211R reverse primer: 5 - CTTCAAGGTGTAAAATGGTC-3, was used for the gene amplification, followed by restriction digestion with Ava II. DNA concentrations were quantified with a NanoDrop-1000 spectrophotometer. Restriction fragment length polymorphism (RFLP) techniques were used for genotyping and Gel electrophoresis to determine the heterozygosity and homozygosity of UGT1A1 alleles. After the polymerase chain reaction (PCR), all DNA samples appeared at 280 base pairs on a 1% agarose gel electrophoretic medium. RFLP analysis confirmed the PCR results; thus, no mutations were observed in all the samples. There were no UGT1A1 genetic polymorphisms among the ethnic groups studied, although there was a mild significant link between dolutegravir and neuropsychiatric side effects in the patients (at p-value = 0.08).
References
Archibald, M., Pritchard, T., Nehoff, H., Rosengren, R. J., Greish, K., & Taurin, S. (2016). A combination of sorafenib and nilotinib reduces the growth of castrate-resistant prostate cancer. Int J Nanomedicine, 11, 179-200. DOI: https://doi.org/10.2147/IJN.S97286
Bessenyei, B., Marka, M., Urban, L., Zeher, M., & Semsei, I. (2004). Single nucleotide polymorphisms: aging and diseases. Biogerontology, 5(5), 291-303. DOI: https://doi.org/10.1007/s10522-004-2567-y
Bunu, S. J., Denmo Otele, Tolulope Alade, & Dodoru, R. T. (2020). Determination of Serum DNA Purity among Patients Undergoing Antiretroviral Therapy using NanoDrop‑1000 Spectrophotometer and Polymerase Chain Reaction. Biomedical and Biotechnology Research Journal, 4, 214-219. DOI: https://doi.org/10.4103/bbrj.bbrj_68_20
Bunu, S. J., Owaba, A. D. C., Vaikosen, E. N., & Ebeshi, B. U. (2022). The Cyp2b6 Gene Polymorphism and Phenotypic Correlation of Efavirenz-Based Combination Therapy Among the Niger Delta Ethnic Population: Implications in Modern Pharmacogenomics. Pharmgenomics Pers Med, 15, 45-54. DOI: https://doi.org/10.2147/PGPM.S345038
Chang, J. H., Plise, E., Cheong, J., Ho, Q., & Lin, M. (2013). Evaluating the in vitro inhibition of UGT1A1, OATP1B1, OATP1B3, MRP2, and BSEP in predicting drug-induced hyperbilirubinemia. Mol Pharm, 10(8), 3067-3075. DOI: https://doi.org/10.1021/mp4001348
Chauhan, T. (2018 ). Genetic Mutations- Definition, Types, Causes and Examples. Genetic Education, Mutation Retrieved 01 August 2023, from https://geneticeducation.co.in/genetic-mutations-definition-types-causes-and-examples/
Daniels, G. (2005). The molecular genetics of blood group polymorphism. Transpl Immunol, 14(3-4), 143-153. DOI: https://doi.org/10.1016/j.trim.2005.03.003
Dean, L. (2012). Irinotecan Therapy and UGT1A1 Genotype. In V. M. Pratt, S. A. Scott, M. Pirmohamed, B. Esquivel, B. L. Kattman, & A. J. Malheiro (Eds.), Medical Genetics Summaries. https://www.ncbi.nlm.nih.gov/pubmed/28520360
Ebeshi, U. B., Oluseye, O. B., & Collen, M. M. (2011). Cytochrome P450 2D6 (CYP2D6) Genotype and Phenotype Determination in Nigeria Population. Asian Journal of Pharmaceutical and Health Sciences, 1(2), 47-54. https://ajphs.com/sites/default/files/AsianJPharmHealthSci-1-2-47.pdf
Fantauzzi, A., & Mezzaroma, I. (2014). Dolutegravir: clinical efficacy and role in HIV therapy. Ther Adv Chronic Dis, 5(4), 164-177. DOI: https://doi.org/10.1177/2040622314530461
Fasinu, P. S., & Rapp, G. K. (2019). Herbal Interaction With Chemotherapeutic Drugs - A Focus on Clinically Significant Findings. Front Oncol, 9, 1356. DOI: https://doi.org/10.3389/fonc.2019.01356
Gervai, J. (2009). Environmental and genetic influences on early attachment. Child Adolesc Psychiatry Ment Health, 3(1), 25. DOI: https://doi.org/10.1186/1753-2000-3-25
Gil, J., & Sasiadek, M. M. (2012). Gilbert syndrome: the UGT1A1*28 promoter polymorphism as a biomarker of multifactorial diseases and drug metabolism. Biomark Med, 6(2), 223-230. DOI: https://doi.org/10.2217/bmm.12.4
Goon, C. P., Wang, L. Z., Wong, F. C., Thuya, W. L., Ho, P. C., & Goh, B. C. (2016). UGT1A1 Mediated Drug Interactions and its Clinical Relevance. Curr Drug Metab, 17(2), 100-106. DOI: https://doi.org/10.2174/1389200216666151103121253
Huang, W., Zhang, J., & Moore, D. D. (2004). A traditional herbal medicine enhances bilirubin clearance by activating the nuclear receptor CAR. J Clin Invest, 113(1), 137-143. DOI: https://doi.org/10.1172/JCI200418385
Huik, K., Hill, S., George, J., Pau, A., Kuriakose, S., Lange, C. M., Dee, N., Stoll, P., Khan, M., Rehman, T., Rehm, C. A., Dewar, R., Grossman, Z., & Maldarelli, F. (2022). High-level dolutegravir resistance can emerge rapidly from few variants and spread by recombination: implications for integrase strand transfer inhibitor salvage therapy. AIDS, 36(13), 1835-1840. DOI: https://doi.org/10.1097/QAD.0000000000003288
Ismail, S. E., Mona. (2012). Genetic polymorphism studies in humans. Middle East Journal of Medical Genetics, 1(2), 57-63,. DOI: https://doi.org/10.1097/01.MXE.0000415225.85003.47
Janeway, C. J., Travers, P., & Walport, M. (2001). Immunobiology: The Immune System in Health and Disease. In Inherited immunodeficiency diseases (Vol. 5th edition). Garland Science. https://www.ncbi.nlm.nih.gov/books/NBK27109/
Liehr, T. (2021). Repetitive Elements in Humans. Int J Mol Sci, 22(4). DOI: https://doi.org/10.3390/ijms22042072
Lv, X., Xia, Y., Finel, M., Wu, J., Ge, G., & Yang, L. (2019). Recent progress and challenges in screening and characterization of UGT1A1 inhibitors. Acta Pharm Sin B, 9(2), 258-278. DOI: https://doi.org/10.1016/j.apsb.2018.09.005
Mahdieh, N., & Rabbani, B. (2013). An overview of mutation detection methods in genetic disorders. Iran J Pediatr, 23(4), 375-388. https://www.ncbi.nlm.nih.gov/pubmed/24427490
Marques, S. C., & Ikediobi, O. N. (2010). The clinical application of UGT1A1 pharmacogenetic testing: gene-environment interactions. Hum Genomics, 4(4), 238-249. DOI: https://doi.org/10.1186/1479-7364-4-4-238
McCormack, P. L. (2014). Dolutegravir: a review of its use in the management of HIV-1 infection in adolescents and adults. Drugs, 74(11), 1241-1252. DOI: https://doi.org/10.1007/s40265-014-0256-y
Meech, R., Hu, D. G., McKinnon, R. A., Mubarokah, S. N., Haines, A. Z., Nair, P. C., Rowland, A., & Mackenzie, P. I. (2019). The UDP-Glycosyltransferase (UGT) Superfamily: New Members, New Functions, and Novel Paradigms. Physiol Rev, 99(2), 1153-1222. DOI: https://doi.org/10.1152/physrev.00058.2017
Mi, X. X., Yan, J., Ma, X. J., Zhu, G. L., Gao, Y. D., Yang, W. J., Kong, X. W., Chen, G. Y., Shi, J. P., & Gong, L. (2019). Analysis of the UGT1A1 Genotype in Hyperbilirubinemia Patients: Differences in Allele Frequency and Distribution. Biomed Res Int, 2019, 6272174. DOI: https://doi.org/10.1155/2019/6272174
Mirambeau, G. (2008). [How proviral DNA is integrated into the host cell DNA and how this process can be inhibited]. Enferm Infecc Microbiol Clin, 26 Suppl 12, 11-16. (Como se integra el ADN proviral en el ADN de la celula del huesped y como se puede inhibir el proceso.) DOI: https://doi.org/10.1016/S0213-005X(08)76567-4
Mroziewicz, M., & Tyndale, R. F. (2010). Pharmacogenetics: a tool for identifying genetic factors in drug dependence and response to treatment. Addict Sci Clin Pract, 5(2), 17-29. https://www.ncbi.nlm.nih.gov/pubmed/22002450
NIH. (2017). Understanding Genetic Variance and Phenotype Expression. In E. National Academies of Sciences, and Medicine; Health and Medicine Division; Board on Health Care Services; Board on the Health of Select Populations; Committee on the Evidence Base for Genetic Testing. (Ed.), An Evidence Framework for Genetic Testing. National Academies Press (US). https://www.ncbi.nlm.nih.gov/books/NBK425811/
Oates, J. T., & Lopez, D. (2018). Pharmacogenetics: An Important Part of Drug Development with A Focus on Its Application. Int J Biomed Investig, 1(2). DOI: https://doi.org/10.31531/2581-4745.1000111
Rhee, S. Y., Grant, P. M., Tzou, P. L., Barrow, G., Harrigan, P. R., Ioannidis, J. P. A., & Shafer, R. W. (2019). A systematic review of the genetic mechanisms of dolutegravir resistance. J Antimicrob Chemother, 74(11), 3135-3149. DOI: https://doi.org/10.1093/jac/dkz256
Ribera, E., & Podzamczer, D. (2015). Mechanisms of action, pharmacology, and interactions of dolutegravir. Enferm Infecc Microbiol Clin, 33 Suppl 1, 2-8. (Mecanismo de accion, farmacologia e interacciones de dolutegravir.) DOI: https://doi.org/10.1016/S0213-005X(15)30002-1
Rishishwar, L., Tellez Villa, C. E., & Jordan, I. K. (2015). Transposable element polymorphisms recapitulate human evolution. Mob DNA, 6, 21. DOI: https://doi.org/10.1186/s13100-015-0052-6
Rozas, J. (2009). DNA sequence polymorphism analysis using DnaSP. Methods Mol Biol, 537, 337-350. DOI: https://doi.org/10.1007/978-1-59745-251-9_17
Surendiran, A., Pradhan, S. C., & Adithan, C. (2008). Role of pharmacogenomics in drug discovery and development. Indian J Pharmacol, 40(4), 137-143. DOI: https://doi.org/10.4103/0253-7613.43158
Teh, L. K., Hashim, H., Zakaria, Z. A., & Salleh, M. Z. (2012). Polymorphisms of UGT1A1*6, UGT1A1*27, and UGT1A1*28 in three major ethnic groups from Malaysia. Indian J Med Res, 136(2), 249-259. https://www.ncbi.nlm.nih.gov/pubmed/22960892
Tiffon, C. (2018). The Impact of Nutrition and Environmental Epigenetics on Human Health and Disease. Int J Mol Sci, 19(11). DOI: https://doi.org/10.3390/ijms19113425
WHO. (2023). HIV and AIDS https://www.who.int/news-room/fact-sheets/detail/hiv-aids
Yagura, H., Watanabe, D., Kushida, H., Tomishima, K., Togami, H., Hirano, A., Takahashi, M., Hirota, K., Ikuma, M., Kasai, D., Nishida, Y., Yoshino, M., Yamazaki, K., Uehira, T., & Shirasaka, T. (2017). Impact of UGT1A1 gene polymorphisms on plasma dolutegravir trough concentrations and neuropsychiatric adverse events in Japanese individuals infected with HIV-1. BMC Infect Dis, 17(1), 622. DOI: https://doi.org/10.1186/s12879-017-2717-x
Yang, N., Sun, R., Liao, X., Aa, J., & Wang, G. (2017). UDP-glucuronosyltransferases (UGTs) and their related metabolic cross-talk with internal homeostasis: A systematic review of UGT isoforms for precision medicine. Pharmacol Res, 121, 169-183. DOI: https://doi.org/10.1016/j.phrs.2017.05.001
Yang, Y., Zhou, M., Hu, M., Cui, Y., Zhong, Q., Liang, L., & Huang, F. (2018). UGT1A1*6 and UGT1A1*28 polymorphisms are correlated with irinotecan-induced toxicity: A meta-analysis. Asia Pac J Clin Oncol, 14(5), e479-e489. DOI: https://doi.org/10.1111/ajco.13028
Zhou, Y., Fu, W. B., Si, F. L., Yan, Z. T., Zhang, Y. J., He, Q. Y., & Chen, B. (2019). UDP-glycosyltransferase genes and their association and mutations associated with pyrethroid resistance in Anopheles sinensis (Diptera: Culicidae). Malar J, 18(1), 62. DOI: https://doi.org/10.1186/s12936-019-2705-2
Zhu, Y. D., Guan, X. Q., Chen, J., Peng, S., Finel, M., Zhao, Y. Y., Wang, R. M., Bi, H. C., Lei, M., Wang, D. D., & Ge, G. B. (2020). Neobavaisoflavone Induces Bilirubin Metabolizing Enzyme UGT1A1 via PPARalpha and PPARgamma. Front Pharmacol, 11, 628314. DOI: https://doi.org/10.3389/fphar.2020.628314
Downloads
Published
Issue
Section
License

This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.
UMYU Scientifica recognizes the importance of protecting authors’ intellectual property while promoting the free exchange of scientific knowledge. The journal adopts a copyright-retention model that empowers authors to maintain ownership of their work while granting the journal rights necessary for publication and dissemination.
1. Copyright Ownership
Authors publishing with UMYU Scientifica retain full copyright and publishing rights to their work. By submitting a manuscript, authors agree to grant the journal a non-exclusive license to publish, reproduce, distribute, and archive the article in all forms and media for the purpose of scholarly communication.
2. Licensing Terms
All articles are published under the Creative Commons Attribution–NonCommercial (CC BY-NC) license.
This license permits others to:
- Share - copy and redistribute the material in any medium or format.
- Adapt - remix, transform, and build upon the material.
- For non-commercial purposes only, provided that proper credit is given to the original author(s) and UMYU Scientifica as the source, a link to the license is provided, and any modifications are clearly indicated.
Commercial reuse or distribution of the content requires written permission from both the author and the editorial office.
3. Author Rights
Authors are free to:
- Deposit all versions of their manuscript (preprint, accepted version, and published version) in institutional, disciplinary, or public repositories without embargo.
- Use and distribute their published article for non-commercial scholarly purposes, including teaching, conference presentations, and research sharing.
- Include their work in future books, theses, or compilations, provided proper citation to the journal is made.
4. Publisher’s Rights
Upon publication, UMYU Scientifica retains the right to:
- Host, index, and disseminate the article through the journal’s website and partner databases.
- Archive the content in long-term preservation systems such as the PKP Preservation Network (PKP-PN) and the Umaru Musa Yar’adua University Institutional Repository.
5. Attribution and Citation
Users must give appropriate credit to the author(s), include a link to the article’s DOI or the journal webpage, and indicate if changes were made. Proper citation is required whenever the work is reused or referenced.
6. License Reference
For detailed terms of use, please refer to the Creative Commons Attribution–NonCommercial 4.0 International License (CC BY-NC 4.0):
https://creativecommons.org/licenses/by-nc/4.0/









